Afternoon Ascospore Release in Claviceps purpurea Optimizes Perennial Ryegrass Infection

Alderman, S. C., Walenta, D., Hamm, P. B., Martin, R. C., Dung, J., and Kosman, E. 2015. Afternoon ascospore release in Claviceps purpurea optimizes perennial ryegrass infection. Plant Dis. 99:1410-1415. In Kentucky bluegrass (Poa pratensis),Claviceps purpurea, the causal agent of ergot, typically releases ascospores during the early-morning hours, between about midnight and 10:00 A.M., corresponding to time of flowering, when the unfertilized ovaries are most susceptible to infection. During aeromycology studies of C. purpurea in perennial ryegrass (Lolium perenne) in northeastern Oregon during 2008 to 2010 and 2013, a strain of C. purpurea was found that released ascospores in the afternoon, coinciding with flowering in perennial ryegrass. Under controlled environmental conditions, sclerotia from perennial ryegrass and Kentucky bluegrass released spores in the afternoon and morning, respectively, consistent with timing of spore release under field conditions. Internal transcribed spacer (ITS) sequences of single sclerotial isolates fromKentucky bluegrass and perennial ryegrass were consistent withC. purpurea, although minor variations in ITS sequences among isolates were noted. Differences between Kentucky bluegrass and perennial ryegrass isolates were observed in random amplified polymorphicDNA. Evidence is provided for adaptation of C. purpurea to perennial ryegrass by means of delayed spore release that coincides with afternoon flowering in perennial ryegrass. Kentucky bluegrass (Poa pratensis L.) (KBG) and perennial ryegrass (Lolium perenne L.) (PRG) are important seed crops in Oregon. Most of the PRG production is in the Willamette Valley, in western Oregon, although production in eastern Oregon, including the Columbia Basin in Umatilla and Morrow counties, has increased over the past decade to about 1,345 ha in 2013 (http://cropandsoil. oregonstate.edu/system/files/u1473/CRD031314-p2.pdf). KBG production occurs almost entirely in eastern Oregon, including central Oregon near Madras, northeastern Oregon in the Grand Ronde Valley near La Grande, and the Columbia Basin. KBG seed production has declined in the Columbia Basin in recent years to about 1,012 ha (http://cropandsoil.oregonstate.edu/system/files/u1473/CRD031314-p2. pdf) as PRG acreage has increased. Ergot, caused by the floral infecting fungus Claviceps purpurea (Fr.) Tul., is a long-standing problem in KBG production in central and northeastern Oregon (Alderman et al. 1996 1998). Over the past decade, the occurrence and severity of ergot in PRG in the Columbia Basin has increased. About the time of host flowering in the spring, ascospores of C. purpurea are released from overwintering sclerotia and infect grass ovaries. Conidia are produced on the surface of colonized ovaries and mix with plant sap in what is commonly referred to as the honeydew stage. Conidia can contribute to secondary spread via insects, rain splashing, or mechanical contact. By the time of host seed maturity, most of the infected ovaries have been converted to elongated black sclerotia. C. purpurea has a wide host range, including about 165 species in the United States (Alderman et al. 2004). Aeromycology studies in KBG indicate that most ascospores are released between late night and early morning, corresponding to flowering in KBG (Alderman 1993; Alderman et al. 2010), with few ascospores airborne in the afternoon. PRG, however, typically flowers in the afternoon. In aeromycology studies of C. purpurea in PRG in the Columbia Basin during 2008 (conducted in parallel with a study in KBG; Alderman et al. 2010), two peaks of airborne ascospores of C. purpurea occurred: one at night to early morning, typical for C. purpurea spore release, and a second in the afternoon. This was unexpected andwe are not aware of any other cases of a shift in timing of ascospore release in C. purpurea. The objectives of this study were to (i) determine whether an afternoon release of ascospores of C. purpurea in PRG was consistently observed in PRG fields over years and locations, (ii) determine whether the afternoon ascospore release from PRG sclerotia and early-morning ascospore release from KBG sclerotia would occur under controlled environmental conditions, and (iii) determine whether Claviceps isolates collected from PRG and KBG were C. purpurea or different Claviceps spp. Materials and Methods Timing of release of ascospores under field conditions. To determine the peak periods of ascospore release, airborne ascospores were monitored with Burkard 7-day volumetric spore traps. The traps were placed near the center of a 51-ha commercial PRG field planted in 2007, near Hermiston, OR (site 1) fromMay to July in 2008, 2009, and 2010. A parallel study in KBG near La Grande, OR was previously published (Alderman et al. 2010). In 2010, 5.82 kg of C. purpurea sclerotia (estimated 4.6 million sclerotia), obtained from seed cleaning facilities in Hermiston that cleaned seed from a PRG field, were dispersed by hand over a field plot (12 by 37 m) of PRG at the Oregon State University Hermiston Agricultural Research and Extension Center (site 2), and a spore trap was placed in the center of the plot. In 2013, a spore trap was placed in a 50-ha commercial PRG field near Hermiston, OR (site 3). At each site, the spore traps were positioned with the orifice approximately 42 cm above the ground and the air intake was maintained at 10 liters/min. Air intake Corresponding author: S. C. Alderman; E-mail: [email protected] *The e-Xtra logo stands for “electronic extra” and indicates that one supplementary figure is published online. Accepted for publication 15 March 2015. http://dx.doi.org/10.1094/PDIS-09-14-0978-RE This article is in the public domain and not copyrightable. It may be freely reprinted with customary crediting of the source. The American Phytopathological Society, 2015. 1410 Plant Disease /Vol. 99 No. 10 was checked at least once weekly. Spore tapes were prepared, processed, and examined as previously described (Alderman 1993). Spore trap tapes (uncoated Melinex; DuPont) were coated with a thin layer of silicone grease. After 1 week of exposure, each tape was cut into daily segments, and hourly partitions were marked by lightly pressing the edge of a single-edge razor blade to the tape over a template with hours marked. Tapes were stainedwith aniline blue (Alderman 1993), covered with a cover glass, sealed with Permount (Fisher Scientific), and examined under an Olympus BX50 microscope (Olympus Corp.) at ×100 or ×200. To estimate the time of flowering, the time of pollen release was determined. The number of pollen grains andC. purpurea ascospores on spore tapes were counted for each hour and then totaled between 12:00 A.M. and 11:59 P.M. to establish daily counts. Ascospore counts for each site and year were expressed as a percentage of total ascospores trapped at the site. Reference slides of known C. purpurea ascospores were prepared by placing two sclerotia with mature capitula in each of four petri plates lined with moist tissue paper and attaching prepared spore trap tape onto the inside of each petri plate lid. The sclerotia were collected from KBG seed production fields and germinated in each of four pots with a commercial potting mix (Sunshine SB40; Sun Grow Horticulture) in a growth chamber. Reference slides of pollen grains were prepared by shaking flowering seed heads from at least three plants of KBG or PRG onto coated Melinex tape segments. The source plants for KBG or PRG pollen were grown from seed in square pots (10 cm wide, one plant per pot) containing commercial potting mix under greenhouse conditions. Slides were stained with aniline blue and processed in the samemanner as the spore trap tapes. Reference slides were referred to for morphological details when identifying ascospores or pollen on spore tapes. Identification of grass pollen to species was not attempted. Timing of ascospore release under controlled environmental conditions. To determine whether the diurnal periodicity of ascospore release observed under field conditions would occur under controlled environmental conditions, ascospore release from C. purpurea sclerotia collected from PRG and KBG was monitored in growth chambers. The experiment was arranged as a two-way factorial completely randomized design (CRD), with sclerotia source (KBG or PRG) and time period (morning or afternoon) as fixed effects. All treatment combinations were replicated four times and the experiment was repeated under the same conditions in a different growth chamber. Mature sclerotia from PRG and KBG were obtained from commercial seed cleaning facilities near Hermiston. The seed cleaning facilities processed seed of PRG and KBG separately by seed lot to ensure that the sclerotia collected were from a single host and seed lot. Sclerotia were surface sterilized in 10% bleach for 1 min and rinsed with sterile deionized water (sdH2O). Sclerotia were incubated without light at 5 to 6°C for 6 weeks in sterilized soil moistened with sdH2O, followed by incubation at 15 to 16°C under 15 h of light and 9 h of darkness for 2 to 4 weeks to induce sclerotia germination and the production of capitula. A single sclerotium was placed in the center of each of four petri plates containing moistened sterile soil. When necessary, capitula were removed from sclerotia so that each sclerotium possessed only one capitulum. Spore production for each capitulum was verified using a dissecting microscope. Melinex tape coated with silicone grease was placed on the lid of the petri plate. Spores were trapped in the morning (between 12:00 and 6:00 A.M.) and afternoon (between 12:00 and 6:00 P.M.). Lids and Melinex tape were replaced every hour at the beginning of each hour. A section of Melinex tape (22 by 22 mm) was removed from the petri plate lid and stained with aniline blue. Tape sections were initially viewed at ×200 magnification and spores were counted at ×400 magnification in five representative views that were each 200 mm in diameter. The number of spores for each hour was determined and totaled for each 6-h morning or afternoon period. Spore counts were converted to the percentage of total spores captured and subjected to arcsine transformation to satisfy assumptions for analysis of variance (ANOVA). ANOVA was conducted using PROC MIXED in SAS (version 9.3; SAS Institute). Data were analyzed as a two-way factorial CRD, with sclerotia source and time period as fixed effects and trial as a random effect. A t test was performed using PROC MIXED and the LSMEANS statement in SAS to compare the percentage of total spores from the morning and afternoon time periods for each host source. Fungal isolates and DNA extraction. DNA was isolated from fungal isolates collected from PRG and KBG fields to facilitate molecular analyses of the population structure of Claviceps from different host species. In June 2010, C. purpurea sclerotia were collected from a commercial PRG field near Hermiston, OR (field 1) and from two KBG fields near La Grande, OR (fields 2 and 3). From each site, 10 sclerotia were surface sterilized by dipping in 95% ethanol for 30 s, soaking in 10% bleach solution for 1 min, and rinsing in sterile water for 15 s. Sclerotia were bisected with a flame-sterilized blade and placed on the surface of water agar in 8.5-cm-diameter petri plates (2 to 3 sclerotia per plate). Isolates were established on Difco potato dextrose agar. For molecular analyses, a 5-mm mycelial plug from each of the 30 isolates was transferred to a 125-ml flask containing 50 ml of Difco potato dextrose broth and cultured at room temperature on a horizontal shaker with slow rotation. One KBG isolate was lost, resulting in 29 total isolates (19 KBG and 10 PRG isolates). After about 3 weeks, fungal mycelia were collected on a filter paper in a Buchner funnel and then rinsed with 100 ml of sdH20 in the Buchner funnel under vacuum. Mycelia were removed from the filter paper and freeze dried. DNA was extracted using the FastDNA Kit from MP Biomedicals, LLC. Approximately 25 mg of freezedried sample was placed in Lysing Matrix C tubes (MP Biomedicals, LLC) and pulverized for 40 s at a setting of 6 using a FastPrep FP120 instrument (BIO101 ThermoSavant). After adding 1 ml of CLS-Y (Cell Lysis/DNA solution Y) to each tube, the samples were mixed by inversion and homogenized twice (setting 6 for 45 s) in the FastPrep 120 instrument. Samples were incubated for 2 h at room temperature and then centrifuged at 12,000 × g for 10 min. The resulting supernatant was processed according to kit instructions. The isolated DNAwas further purified by chloroform extraction, precipitated with ammonium acetate and isopropanol, and washed with 70% ethanol following standard protocols (Sambrook et al. 1989). DNA concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific). All samples were diluted to a concentration of 20 ng/ml for subsequent polymerase chain reaction (PCR). PCR and sequencing of the internal transcribed spacer region. PCR was utilized to amplify the internal transcribed spacer (ITS) region to characterize the Claviceps populations from different host species. Primers for amplifying the ITS regionwere ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC (White et al. 1990). The PCR reaction mix consisted of 1× PrimeSTAR buffer, 0.2 mM each dNTP, 0.3 mM primers, 20 ng of DNA, and 1.25 U of PrimeSTAR HS DNA Polymerase (Takara) in a final volume of 50 ml. PCR was performed on an MJ PTC 200 thermocycler (Bio-Rad) with the following program: 98°C for 30 s; 30 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 1 min; followed by a 10-min extension at 72°C. The mixture was kept at 4°C until removal from the instrument. PCR products were separated on a 1.2% agarose Tris-acetateEDTA gel and purified using a Qiagen QIAEX Gel Extraction Kit (Qiagen). Products were sequenced in both directions on an ABI Prism 3730 Genetic Analyzer at the Center for Genome Research and Biocomputing at Oregon State University. PCR resulted in a product of approximately 580 bp, including the ITS1, 5.8S, and ITS2 region of the ribosomal cassette. Sequences were aligned using ClustalW (Larkin et al. 2007). Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 5 (Tamura et al. 2011). Random amplified polymorphic DNA analysis. Random amplified polymorphic DNA (RAPD) was used to determine the relationship between populations of Claviceps from different host species. Primer 257 (CGTGATGTCAGTGATGC) (Pažoutová et al. 2000) was utilized for RAPD analyses. Each reaction contained dNTPs at a concentration of 200 mM, 12.5 pM primer, 1× ExTaq PCR buffer (Takara), 0.1 ml of dimethyl sulfoxide, 25 ng of DNA, and 0.125 ml of ExTaq in a 25-ml reaction. The cycling conditions were as follows: Plant Disease /October 2015 1411 94°C for 4 min; 45 cycles of 94°C for 20 s, 38°C for 1 min, and 72°C for 2 min; followed by 72°C for 6 min and a 4°C hold until removal from the thermocycler. The products were separated on a 2% agarose gel in Tris-borate-EDTA buffer at 75 V for 12 h, stained with ethidium bromide, and visualized with a UVP gel documentation system (UVP). The major RAPD bands (approximately 540, 720, 750, 780, 900, 1,400, and 1,700 bp) were scored as 1 (present) or 0 (absent) for each individual, and pairwise dissimilarities between the RAPD patterns of isolates were measured by the simple mismatch (m) and Jaccard (j) coefficients, as was recommended for dominant markers by Kosman and Leonard (2005). Relationships between populations were estimated using theKosman distance (KBm andKBj) with regard to the simplemismatch and Jaccard dissimilarity, respectively (Kosman 1996; Kosman and Leonard 2007). Differentiation among populations was assessed with the permutation test on the basis of the Kosman diversity (KWm and KWj) with regard to the simple mismatch and Jaccard dissimilarity, respectively (Kosman 2014; Kosman et al. 2014). All calculations were performed with the Virulence Analysis Tool software and its extension (Schachtel et al. 2012).